data_50671
#######################
# Entry information #
#######################
save_entry_information_1
_Entry.Sf_category entry_information
_Entry.Sf_framecode entry_information_1
_Entry.ID 50671
_Entry.Title
;
5_SL5
;
_Entry.Type macromolecule
_Entry.Version_type original
_Entry.Submission_date 2020-12-20
_Entry.Accession_date 2020-12-20
_Entry.Last_release_date 2021-06-28
_Entry.Original_release_date 2021-06-28
_Entry.Origination author
_Entry.Format_name .
_Entry.NMR_STAR_version 3.2.14.0
_Entry.NMR_STAR_dict_location .
_Entry.Original_NMR_STAR_version 3.1
_Entry.Experimental_method NMR
_Entry.Experimental_method_subtype solution
_Entry.Source_data_format .
_Entry.Source_data_format_version .
_Entry.Generated_software_name .
_Entry.Generated_software_version .
_Entry.Generated_software_ID .
_Entry.Generated_software_label .
_Entry.Generated_date .
_Entry.DOI .
_Entry.UUID .
_Entry.Related_coordinate_file_name .
_Entry.Details .
_Entry.BMRB_internal_directory_name .
loop_
_Entry_author.Ordinal
_Entry_author.Given_name
_Entry_author.Family_name
_Entry_author.First_initial
_Entry_author.Middle_initials
_Entry_author.Family_title
_Entry_author.ORCID
_Entry_author.Entry_ID
1 Harald Schwalbe . . . . 50671
2 Sridhar Sreeramulu . . . . 50671
3 Christian Richter . . . . 50671
stop_
loop_
_Entry_src.ID
_Entry_src.Project_name
_Entry_src.Organization_full_name
_Entry_src.Organization_initials
_Entry_src.Entry_ID
1 'SARS-CoV-2 RNA screening study' 'Harald Schwalbe group; Goethe University Frankfurt' . 50671
stop_
loop_
_Release.Release_number
_Release.Format_type
_Release.Format_version
_Release.Date
_Release.Submission_date
_Release.Type
_Release.Author
_Release.Detail
_Release.Entry_ID
1 . . 2022-02-01 . original BMRB . 50671
stop_
loop_
_Related_entries.Database_name
_Related_entries.Database_accession_code
_Related_entries.Relationship
_Related_entries.Entry_ID
NCBI NC_045512.2 'Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome.' 50671
stop_
save_
###############
# Citations #
###############
save_citations_1
_Citation.Sf_category citations
_Citation.Sf_framecode citations_1
_Citation.Entry_ID 50671
_Citation.ID 1
_Citation.Name 'citations 1'
_Citation.Class 'entry citation'
_Citation.CAS_abstract_code .
_Citation.MEDLINE_UI_code .
_Citation.PubMed_ID 34161644
_Citation.DOI 10.1002/anie.202103693
_Citation.Full_citation .
_Citation.Title
;
Exploring the druggability of conserved RNA regulatory elements in the SARS-CoV-2 genome
;
_Citation.Status published
_Citation.Type journal
_Citation.Journal_abbrev 'Angew. Chem. Int. Ed. Engl.'
_Citation.Journal_name_full 'Angewandte Chemie (International ed. in English)'
_Citation.Journal_volume 60
_Citation.Journal_issue 35
_Citation.Journal_ASTM .
_Citation.Journal_ISSN 1521-3773
_Citation.Journal_CSD .
_Citation.Book_title .
_Citation.Book_chapter_title .
_Citation.Book_volume .
_Citation.Book_series .
_Citation.Book_publisher .
_Citation.Book_publisher_city .
_Citation.Book_ISBN .
_Citation.Conference_title .
_Citation.Conference_site .
_Citation.Conference_state_province .
_Citation.Conference_country .
_Citation.Conference_start_date .
_Citation.Conference_end_date .
_Citation.Conference_abstract_number .
_Citation.Thesis_institution .
_Citation.Thesis_institution_city .
_Citation.Thesis_institution_country .
_Citation.WWW_URL .
_Citation.Page_first 19191
_Citation.Page_last 19200
_Citation.Year 2021
_Citation.Details .
loop_
_Citation_author.Ordinal
_Citation_author.Given_name
_Citation_author.Family_name
_Citation_author.First_initial
_Citation_author.Middle_initials
_Citation_author.Family_title
_Citation_author.ORCID
_Citation_author.Entry_ID
_Citation_author.Citation_ID
1 Sridhar Sreeramulu S. . . . 50671 1
2 Christian Richter C. . . . 50671 1
3 Hannes Berg H. . . . 50671 1
4 Maria 'Wirtz Martin' M. A. . . 50671 1
5 Betul Ceylan B. . . . 50671 1
6 Tobias Matzel T. . . . 50671 1
7 Jennifer Adam J. . . . 50671 1
8 Nadide Altincekic N. . . . 50671 1
9 Kamal Azzaoui K. . . . 50671 1
10 'Jasleen Kaur' Bains J. K. . . 50671 1
11 Marcel Blommers . . . . 50671 1
12 Jan Ferner J. . . . 50671 1
13 Boris Furtig B. . . . 50671 1
14 M. Gobel M. . . . 50671 1
15 'J Tassilo' Grun J. T. . . 50671 1
16 Martin Hengesbach M. . . . 50671 1
17 Katharina Hohmann K. F. . . 50671 1
18 Daniel Hymon D. . . . 50671 1
19 Bozana Knezic B. . . . 50671 1
20 Jason Martins J. . . . 50671 1
21 Klara Mertinkus K. R. . . 50671 1
22 Anna Niesteruk A. . . . 50671 1
23 Stephen Peter S. A. . . 50671 1
24 Dennis Pyper D. J. . . 50671 1
25 Nusrat Qureshi N. S. . . 50671 1
26 Ute Scheffer U. . . . 50671 1
27 Andreas Schlundt A. . . . 50671 1
28 Robbin Schnieders R. . . . 50671 1
29 Elke Stirnal E. . . . 50671 1
30 Alexey Sudakov A. . . . 50671 1
31 Alix Troster A. . . . 50671 1
32 Jennifer Vogele J. . . . 50671 1
33 Anna Wacker A. . . . 50671 1
34 Julia Weigand J. E. . . 50671 1
35 Julia Wirmer-Bartoschek J. . . . 50671 1
36 Jens Wohnert J. . . . 50671 1
37 Harald Schwalbe H. . . . 50671 1
stop_
save_
#############################################
# Molecular system (assembly) description #
#############################################
save_assembly_1
_Assembly.Sf_category assembly
_Assembly.Sf_framecode assembly_1
_Assembly.Entry_ID 50671
_Assembly.ID 1
_Assembly.Name '5_SL5 fragment screening'
_Assembly.BMRB_code .
_Assembly.Number_of_components 2
_Assembly.Organic_ligands 0
_Assembly.Metal_ions 0
_Assembly.Non_standard_bonds no
_Assembly.Ambiguous_conformational_states no
_Assembly.Ambiguous_chem_comp_sites .
_Assembly.Molecules_in_chemical_exchange yes
_Assembly.Paramagnetic no
_Assembly.Thiol_state .
_Assembly.Molecular_mass .
_Assembly.Enzyme_commission_number .
_Assembly.Details .
_Assembly.DB_query_date .
_Assembly.DB_query_revised_last_date .
loop_
_Entity_assembly.ID
_Entity_assembly.Entity_assembly_name
_Entity_assembly.Entity_ID
_Entity_assembly.Entity_label
_Entity_assembly.Asym_ID
_Entity_assembly.PDB_chain_ID
_Entity_assembly.Experimental_data_reported
_Entity_assembly.Physical_state
_Entity_assembly.Conformational_isomer
_Entity_assembly.Chemical_exchange_state
_Entity_assembly.Magnetic_equivalence_group_code
_Entity_assembly.Role
_Entity_assembly.Details
_Entity_assembly.Entry_ID
_Entity_assembly.Assembly_ID
1 5_SL5 1 $entity_1 . . no native no no . . . 50671 1
2 'DSI-Poised Library (DSI-PL)' 2 $entity_2 . . yes native no yes . . . 50671 1
stop_
save_
####################################
# Biological polymers and ligands #
####################################
save_entity_1
_Entity.Sf_category entity
_Entity.Sf_framecode entity_1
_Entity.Entry_ID 50671
_Entity.ID 1
_Entity.BMRB_code .
_Entity.Name entity_1
_Entity.Type polymer
_Entity.Polymer_common_type .
_Entity.Polymer_type polyribonucleotide
_Entity.Polymer_type_details .
_Entity.Polymer_strand_ID .
_Entity.Polymer_seq_one_letter_code_can .
_Entity.Polymer_seq_one_letter_code
;
GGUCGUUGACAGGACACGAG
UAACUCGUCUAUCUUCUGCA
GGCUGCUUACGGUUUCGUCC
GUGUUGCAGCCGAUCAUCAG
CACAUCUAGGUUUCGUCCGG
GUGUGACCGAAAGGUAAGAU
GGAGAGCCUUGUCCCUGGUU
UCAACGAGAA
;
_Entity.Target_identifier .
_Entity.Polymer_author_defined_seq .
_Entity.Polymer_author_seq_details .
_Entity.Ambiguous_conformational_states no
_Entity.Ambiguous_chem_comp_sites no
_Entity.Nstd_monomer no
_Entity.Nstd_chirality no
_Entity.Nstd_linkage no
_Entity.Nonpolymer_comp_ID .
_Entity.Nonpolymer_comp_label .
_Entity.Number_of_monomers 150
_Entity.Number_of_nonpolymer_components .
_Entity.Paramagnetic no
_Entity.Thiol_state 'not present'
_Entity.Src_method .
_Entity.Parent_entity_ID 1
_Entity.Fragment .
_Entity.Mutation .
_Entity.EC_number .
_Entity.Calc_isoelectric_point .
_Entity.Formula_weight .
_Entity.Formula_weight_exptl .
_Entity.Formula_weight_exptl_meth .
_Entity.Details .
_Entity.DB_query_date .
_Entity.DB_query_revised_last_date .
loop_
_Entity_comp_index.ID
_Entity_comp_index.Auth_seq_ID
_Entity_comp_index.Comp_ID
_Entity_comp_index.Comp_label
_Entity_comp_index.Entry_ID
_Entity_comp_index.Entity_ID
1 . G . 50671 1
2 . G . 50671 1
3 . U . 50671 1
4 . C . 50671 1
5 . G . 50671 1
6 . U . 50671 1
7 . U . 50671 1
8 . G . 50671 1
9 . A . 50671 1
10 . C . 50671 1
11 . A . 50671 1
12 . G . 50671 1
13 . G . 50671 1
14 . A . 50671 1
15 . C . 50671 1
16 . A . 50671 1
17 . C . 50671 1
18 . G . 50671 1
19 . A . 50671 1
20 . G . 50671 1
21 . U . 50671 1
22 . A . 50671 1
23 . A . 50671 1
24 . C . 50671 1
25 . U . 50671 1
26 . C . 50671 1
27 . G . 50671 1
28 . U . 50671 1
29 . C . 50671 1
30 . U . 50671 1
31 . A . 50671 1
32 . U . 50671 1
33 . C . 50671 1
34 . U . 50671 1
35 . U . 50671 1
36 . C . 50671 1
37 . U . 50671 1
38 . G . 50671 1
39 . C . 50671 1
40 . A . 50671 1
41 . G . 50671 1
42 . G . 50671 1
43 . C . 50671 1
44 . U . 50671 1
45 . G . 50671 1
46 . C . 50671 1
47 . U . 50671 1
48 . U . 50671 1
49 . A . 50671 1
50 . C . 50671 1
51 . G . 50671 1
52 . G . 50671 1
53 . U . 50671 1
54 . U . 50671 1
55 . U . 50671 1
56 . C . 50671 1
57 . G . 50671 1
58 . U . 50671 1
59 . C . 50671 1
60 . C . 50671 1
61 . G . 50671 1
62 . U . 50671 1
63 . G . 50671 1
64 . U . 50671 1
65 . U . 50671 1
66 . G . 50671 1
67 . C . 50671 1
68 . A . 50671 1
69 . G . 50671 1
70 . C . 50671 1
71 . C . 50671 1
72 . G . 50671 1
73 . A . 50671 1
74 . U . 50671 1
75 . C . 50671 1
76 . A . 50671 1
77 . U . 50671 1
78 . C . 50671 1
79 . A . 50671 1
80 . G . 50671 1
81 . C . 50671 1
82 . A . 50671 1
83 . C . 50671 1
84 . A . 50671 1
85 . U . 50671 1
86 . C . 50671 1
87 . U . 50671 1
88 . A . 50671 1
89 . G . 50671 1
90 . G . 50671 1
91 . U . 50671 1
92 . U . 50671 1
93 . U . 50671 1
94 . C . 50671 1
95 . G . 50671 1
96 . U . 50671 1
97 . C . 50671 1
98 . C . 50671 1
99 . G . 50671 1
100 . G . 50671 1
101 . G . 50671 1
102 . U . 50671 1
103 . G . 50671 1
104 . U . 50671 1
105 . G . 50671 1
106 . A . 50671 1
107 . C . 50671 1
108 . C . 50671 1
109 . G . 50671 1
110 . A . 50671 1
111 . A . 50671 1
112 . A . 50671 1
113 . G . 50671 1
114 . G . 50671 1
115 . U . 50671 1
116 . A . 50671 1
117 . A . 50671 1
118 . G . 50671 1
119 . A . 50671 1
120 . U . 50671 1
121 . G . 50671 1
122 . G . 50671 1
123 . A . 50671 1
124 . G . 50671 1
125 . A . 50671 1
126 . G . 50671 1
127 . C . 50671 1
128 . C . 50671 1
129 . U . 50671 1
130 . U . 50671 1
131 . G . 50671 1
132 . U . 50671 1
133 . C . 50671 1
134 . C . 50671 1
135 . C . 50671 1
136 . U . 50671 1
137 . G . 50671 1
138 . G . 50671 1
139 . U . 50671 1
140 . U . 50671 1
141 . U . 50671 1
142 . C . 50671 1
143 . A . 50671 1
144 . A . 50671 1
145 . C . 50671 1
146 . G . 50671 1
147 . A . 50671 1
148 . G . 50671 1
149 . A . 50671 1
150 . A . 50671 1
stop_
loop_
_Entity_poly_seq.Hetero
_Entity_poly_seq.Mon_ID
_Entity_poly_seq.Num
_Entity_poly_seq.Comp_index_ID
_Entity_poly_seq.Entry_ID
_Entity_poly_seq.Entity_ID
. G 1 1 50671 1
. G 2 2 50671 1
. U 3 3 50671 1
. C 4 4 50671 1
. G 5 5 50671 1
. U 6 6 50671 1
. U 7 7 50671 1
. G 8 8 50671 1
. A 9 9 50671 1
. C 10 10 50671 1
. A 11 11 50671 1
. G 12 12 50671 1
. G 13 13 50671 1
. A 14 14 50671 1
. C 15 15 50671 1
. A 16 16 50671 1
. C 17 17 50671 1
. G 18 18 50671 1
. A 19 19 50671 1
. G 20 20 50671 1
. U 21 21 50671 1
. A 22 22 50671 1
. A 23 23 50671 1
. C 24 24 50671 1
. U 25 25 50671 1
. C 26 26 50671 1
. G 27 27 50671 1
. U 28 28 50671 1
. C 29 29 50671 1
. U 30 30 50671 1
. A 31 31 50671 1
. U 32 32 50671 1
. C 33 33 50671 1
. U 34 34 50671 1
. U 35 35 50671 1
. C 36 36 50671 1
. U 37 37 50671 1
. G 38 38 50671 1
. C 39 39 50671 1
. A 40 40 50671 1
. G 41 41 50671 1
. G 42 42 50671 1
. C 43 43 50671 1
. U 44 44 50671 1
. G 45 45 50671 1
. C 46 46 50671 1
. U 47 47 50671 1
. U 48 48 50671 1
. A 49 49 50671 1
. C 50 50 50671 1
. G 51 51 50671 1
. G 52 52 50671 1
. U 53 53 50671 1
. U 54 54 50671 1
. U 55 55 50671 1
. C 56 56 50671 1
. G 57 57 50671 1
. U 58 58 50671 1
. C 59 59 50671 1
. C 60 60 50671 1
. G 61 61 50671 1
. U 62 62 50671 1
. G 63 63 50671 1
. U 64 64 50671 1
. U 65 65 50671 1
. G 66 66 50671 1
. C 67 67 50671 1
. A 68 68 50671 1
. G 69 69 50671 1
. C 70 70 50671 1
. C 71 71 50671 1
. G 72 72 50671 1
. A 73 73 50671 1
. U 74 74 50671 1
. C 75 75 50671 1
. A 76 76 50671 1
. U 77 77 50671 1
. C 78 78 50671 1
. A 79 79 50671 1
. G 80 80 50671 1
. C 81 81 50671 1
. A 82 82 50671 1
. C 83 83 50671 1
. A 84 84 50671 1
. U 85 85 50671 1
. C 86 86 50671 1
. U 87 87 50671 1
. A 88 88 50671 1
. G 89 89 50671 1
. G 90 90 50671 1
. U 91 91 50671 1
. U 92 92 50671 1
. U 93 93 50671 1
. C 94 94 50671 1
. G 95 95 50671 1
. U 96 96 50671 1
. C 97 97 50671 1
. C 98 98 50671 1
. G 99 99 50671 1
. G 100 100 50671 1
. G 101 101 50671 1
. U 102 102 50671 1
. G 103 103 50671 1
. U 104 104 50671 1
. G 105 105 50671 1
. A 106 106 50671 1
. C 107 107 50671 1
. C 108 108 50671 1
. G 109 109 50671 1
. A 110 110 50671 1
. A 111 111 50671 1
. A 112 112 50671 1
. G 113 113 50671 1
. G 114 114 50671 1
. U 115 115 50671 1
. A 116 116 50671 1
. A 117 117 50671 1
. G 118 118 50671 1
. A 119 119 50671 1
. U 120 120 50671 1
. G 121 121 50671 1
. G 122 122 50671 1
. A 123 123 50671 1
. G 124 124 50671 1
. A 125 125 50671 1
. G 126 126 50671 1
. C 127 127 50671 1
. C 128 128 50671 1
. U 129 129 50671 1
. U 130 130 50671 1
. G 131 131 50671 1
. U 132 132 50671 1
. C 133 133 50671 1
. C 134 134 50671 1
. C 135 135 50671 1
. U 136 136 50671 1
. G 137 137 50671 1
. G 138 138 50671 1
. U 139 139 50671 1
. U 140 140 50671 1
. U 141 141 50671 1
. C 142 142 50671 1
. A 143 143 50671 1
. A 144 144 50671 1
. C 145 145 50671 1
. G 146 146 50671 1
. A 147 147 50671 1
. G 148 148 50671 1
. A 149 149 50671 1
. A 150 150 50671 1
stop_
save_
save_entity_2
_Entity.Sf_category entity
_Entity.Sf_framecode entity_2
_Entity.Entry_ID 50671
_Entity.ID 2
_Entity.BMRB_code .
_Entity.Name entity_2
_Entity.Type non-polymer
_Entity.Polymer_common_type .
_Entity.Polymer_type .
_Entity.Polymer_type_details .
_Entity.Polymer_strand_ID .
_Entity.Polymer_seq_one_letter_code_can .
_Entity.Polymer_seq_one_letter_code .
_Entity.Target_identifier .
_Entity.Polymer_author_defined_seq .
_Entity.Polymer_author_seq_details .
_Entity.Ambiguous_conformational_states no
_Entity.Ambiguous_chem_comp_sites .
_Entity.Nstd_monomer .
_Entity.Nstd_chirality no
_Entity.Nstd_linkage no
_Entity.Nonpolymer_comp_ID .
_Entity.Nonpolymer_comp_label .
_Entity.Number_of_monomers .
_Entity.Number_of_nonpolymer_components .
_Entity.Paramagnetic no
_Entity.Thiol_state 'not present'
_Entity.Src_method .
_Entity.Parent_entity_ID 2
_Entity.Fragment .
_Entity.Mutation .
_Entity.EC_number .
_Entity.Calc_isoelectric_point .
_Entity.Formula_weight .
_Entity.Formula_weight_exptl .
_Entity.Formula_weight_exptl_meth .
_Entity.Details 'This entity represents the 768 compound iNEXT fragment screening library.'
_Entity.DB_query_date .
_Entity.DB_query_revised_last_date .
save_
####################
# Natural source #
####################
save_natural_source_1
_Entity_natural_src_list.Sf_category natural_source
_Entity_natural_src_list.Sf_framecode natural_source_1
_Entity_natural_src_list.Entry_ID 50671
_Entity_natural_src_list.ID 1
loop_
_Entity_natural_src.ID
_Entity_natural_src.Entity_ID
_Entity_natural_src.Entity_label
_Entity_natural_src.Entity_chimera_segment_ID
_Entity_natural_src.NCBI_taxonomy_ID
_Entity_natural_src.Type
_Entity_natural_src.Common
_Entity_natural_src.Organism_name_scientific
_Entity_natural_src.Organism_name_common
_Entity_natural_src.Organism_acronym
_Entity_natural_src.ICTVdb_decimal_code
_Entity_natural_src.Superkingdom
_Entity_natural_src.Kingdom
_Entity_natural_src.Genus
_Entity_natural_src.Species
_Entity_natural_src.Strain
_Entity_natural_src.Variant
_Entity_natural_src.Organ
_Entity_natural_src.Tissue
_Entity_natural_src.Tissue_fraction
_Entity_natural_src.Cell_line
_Entity_natural_src.Cell_type
_Entity_natural_src.ATCC_number
_Entity_natural_src.Organelle
_Entity_natural_src.Secretion
_Entity_natural_src.Plasmid
_Entity_natural_src.Gene_mnemonic
_Entity_natural_src.Details
_Entity_natural_src.Entry_ID
_Entity_natural_src.Entity_natural_src_list_ID
1 1 $entity_1 . 2697049 organism . 'SARS coronavirus 2' SARS-CoV-2 . . Viruses . Betacoronavirus HCoV-SARS SARS-CoV-2 . . . . . . . . . . . . 50671 1
2 2 $entity_2 . . 'no natural source' . . . . . . . . . . . . . . . . . . . . . . 50671 1
stop_
save_
#########################
# Experimental source #
#########################
save_experimental_source_1
_Entity_experimental_src_list.Sf_category experimental_source
_Entity_experimental_src_list.Sf_framecode experimental_source_1
_Entity_experimental_src_list.Entry_ID 50671
_Entity_experimental_src_list.ID 1
loop_
_Entity_experimental_src.ID
_Entity_experimental_src.Entity_ID
_Entity_experimental_src.Entity_label
_Entity_experimental_src.Entity_chimera_segment_ID
_Entity_experimental_src.Production_method
_Entity_experimental_src.Host_org_scientific_name
_Entity_experimental_src.Host_org_name_common
_Entity_experimental_src.Host_org_details
_Entity_experimental_src.Host_org_NCBI_taxonomy_ID
_Entity_experimental_src.Host_org_genus
_Entity_experimental_src.Host_org_species
_Entity_experimental_src.Host_org_strain
_Entity_experimental_src.Host_org_variant
_Entity_experimental_src.Host_org_ATCC_number
_Entity_experimental_src.Vector_type
_Entity_experimental_src.PDBview_host_org_vector_name
_Entity_experimental_src.PDBview_plasmid_name
_Entity_experimental_src.Vector_name
_Entity_experimental_src.Vector_details
_Entity_experimental_src.Vendor_name
_Entity_experimental_src.Details
_Entity_experimental_src.Entry_ID
_Entity_experimental_src.Entity_experimental_src_list_ID
1 1 $entity_1 . transcription in-vitro . . . . . . . . . . . . . . . 50671 1
2 2 $entity_2 . 'chemical synthesis' . . . . . . . . . . . . . . . . 50671 1
stop_
save_
#####################################
# Sample contents and methodology #
#####################################
########################
# Sample description #
########################
save_sample_1
_Sample.Sf_category sample
_Sample.Sf_framecode sample_1
_Sample.Entry_ID 50671
_Sample.ID 1
_Sample.Name 'RNA plus fragment mix'
_Sample.Type solution
_Sample.Sub_type .
_Sample.Details
;
A generic binding experiment sample is described containing the RNA molecule and 12 fragments taken from the DSI-PL.
In all 64 total samples were used each containing 12 fragments from the 768 compound iNEXT fragment library.
;
_Sample.Aggregate_sample_number 1
_Sample.Solvent_system '95% H2O: 5% DMSO'
_Sample.Preparation_date .
_Sample.Preparation_expiration_date .
_Sample.Polycrystallization_protocol .
_Sample.Single_crystal_protocol .
_Sample.Crystal_grow_apparatus .
_Sample.Crystal_grow_atmosphere .
_Sample.Crystal_grow_details .
_Sample.Crystal_grow_method .
_Sample.Crystal_grow_method_cit_ID .
_Sample.Crystal_grow_pH .
_Sample.Crystal_grow_pH_range .
_Sample.Crystal_grow_pressure .
_Sample.Crystal_grow_pressure_esd .
_Sample.Crystal_grow_seeding .
_Sample.Crystal_grow_seeding_cit_ID .
_Sample.Crystal_grow_temp .
_Sample.Crystal_grow_temp_details .
_Sample.Crystal_grow_temp_esd .
_Sample.Crystal_grow_time .
_Sample.Oriented_sample_prep_protocol .
_Sample.Lyophilization_cryo_protectant .
_Sample.Storage_protocol .
loop_
_Sample_component.ID
_Sample_component.Mol_common_name
_Sample_component.Isotopic_labeling
_Sample_component.Assembly_ID
_Sample_component.Assembly_label
_Sample_component.Entity_ID
_Sample_component.Entity_label
_Sample_component.Product_ID
_Sample_component.Type
_Sample_component.Concentration_val
_Sample_component.Concentration_val_min
_Sample_component.Concentration_val_max
_Sample_component.Concentration_val_units
_Sample_component.Concentration_val_err
_Sample_component.Vendor
_Sample_component.Vendor_product_name
_Sample_component.Vendor_product_code
_Sample_component.Entry_ID
_Sample_component.Sample_ID
1 5_SL5 'natural abundance' . . 1 $entity_1 . . 10 . . uM . . . . 50671 1
2 'potassium phosphate' 'natural abundance' . . . . . . 25 . . mM . . . . 50671 1
3 KCl 'natural abundance' . . . . . . 50 . . mM . . . . 50671 1
4 H2O 'natural abundance' . . . . . . 95 . . % . . . . 50671 1
5 DMSO '[U-100% 2H]' . . . . . . 5 . . % . . . . 50671 1
6 'Fragment 1' 'natural abundance' . . . . . . 200 . . uM . . . . 50671 1
7 'Fragment 2' 'natural abundance' . . . . . . 200 . . uM . . . . 50671 1
8 'Fragment 3' 'natural abundance' . . . . . . 200 . . uM . . . . 50671 1
9 'Fragment 4' 'natural abundance' . . . . . . 200 . . uM . . . . 50671 1
10 'Fragment 5' 'natural abundance' . . . . . . 200 . . uM . . . . 50671 1
11 'Fragment 6' 'natural abundance' . . . . . . 200 . . uM . . . . 50671 1
12 'Fragment 7' 'natural abundance' . . . . . . 200 . . uM . . . . 50671 1
13 'Fragment 8' 'natural abundance' . . . . . . 200 . . uM . . . . 50671 1
14 'Fragment 9' 'natural abundance' . . . . . . 200 . . uM . . . . 50671 1
15 'Fragment 10' 'natural abundance' . . . . . . 200 . . uM . . . . 50671 1
16 'Fragment 11' 'natural abundance' . . . . . . 200 . . uM . . . . 50671 1
17 'Fragment 12' 'natural abundance' . . . . . . 200 . . uM . . . . 50671 1
stop_
save_
save_sample_2
_Sample.Sf_category sample
_Sample.Sf_framecode sample_2
_Sample.Entry_ID 50671
_Sample.ID 2
_Sample.Name 'Fragment mix reference'
_Sample.Type solution
_Sample.Sub_type .
_Sample.Details
;
A generic reference sample is described containing 12 fragments taken from the iNEXT fragment library.
In total 64 samples were used containing each containing a set of 12 fragments from the 768 compound
iNEXT fragment library matched as reference samples to the 64 samples used in the binding study.
;
_Sample.Aggregate_sample_number 1
_Sample.Solvent_system '95% H2O: 5% DMSO'
_Sample.Preparation_date .
_Sample.Preparation_expiration_date .
_Sample.Polycrystallization_protocol .
_Sample.Single_crystal_protocol .
_Sample.Crystal_grow_apparatus .
_Sample.Crystal_grow_atmosphere .
_Sample.Crystal_grow_details .
_Sample.Crystal_grow_method .
_Sample.Crystal_grow_method_cit_ID .
_Sample.Crystal_grow_pH .
_Sample.Crystal_grow_pH_range .
_Sample.Crystal_grow_pressure .
_Sample.Crystal_grow_pressure_esd .
_Sample.Crystal_grow_seeding .
_Sample.Crystal_grow_seeding_cit_ID .
_Sample.Crystal_grow_temp .
_Sample.Crystal_grow_temp_details .
_Sample.Crystal_grow_temp_esd .
_Sample.Crystal_grow_time .
_Sample.Oriented_sample_prep_protocol .
_Sample.Lyophilization_cryo_protectant .
_Sample.Storage_protocol .
loop_
_Sample_component.ID
_Sample_component.Mol_common_name
_Sample_component.Isotopic_labeling
_Sample_component.Assembly_ID
_Sample_component.Assembly_label
_Sample_component.Entity_ID
_Sample_component.Entity_label
_Sample_component.Product_ID
_Sample_component.Type
_Sample_component.Concentration_val
_Sample_component.Concentration_val_min
_Sample_component.Concentration_val_max
_Sample_component.Concentration_val_units
_Sample_component.Concentration_val_err
_Sample_component.Vendor
_Sample_component.Vendor_product_name
_Sample_component.Vendor_product_code
_Sample_component.Entry_ID
_Sample_component.Sample_ID
1 'potassium phosphate' 'natural abundance' . . . . . . 25 . . mM . . . . 50671 2
2 KCl 'natural abundance' . . . . . . 50 . . mM . . . . 50671 2
3 H2O 'natural abundance' . . . . . . 95 . . % . . . . 50671 2
4 DMSO '[U-100% 2H]' . . . . . . 5 . . % . . . . 50671 2
5 'Fragment 1' 'natural abundance' . . . . . . 200 . . uM . . . . 50671 2
6 'Fragment 2' 'natural abundance' . . . . . . 200 . . uM . . . . 50671 2
7 'Fragment 3' 'natural abundance' . . . . . . 200 . . uM . . . . 50671 2
8 'Fragment 4' 'natural abundance' . . . . . . 200 . . uM . . . . 50671 2
9 'Fragment 5' 'natural abundance' . . . . . . 200 . . uM . . . . 50671 2
10 'Fragment 6' 'natural abundance' . . . . . . 200 . . uM . . . . 50671 2
11 'Fragment 7' 'natural abundance' . . . . . . 200 . . uM . . . . 50671 2
12 'Fragment 8' 'natural abundance' . . . . . . 200 . . uM . . . . 50671 2
13 'Fragment 9' 'natural abundance' . . . . . . 200 . . uM . . . . 50671 2
14 'Fragment 10' 'natural abundance' . . . . . . 200 . . uM . . . . 50671 2
15 'Fragment 11' 'natural abundance' . . . . . . 200 . . uM . . . . 50671 2
16 'Fragment 12' 'natural abundance' . . . . . . 200 . . uM . . . . 50671 2
stop_
save_
#######################
# Sample conditions #
#######################
save_sample_conditions_1
_Sample_condition_list.Sf_category sample_conditions
_Sample_condition_list.Sf_framecode sample_conditions_1
_Sample_condition_list.Entry_ID 50671
_Sample_condition_list.ID 1
_Sample_condition_list.Name 'RNA binding conditions'
_Sample_condition_list.Details .
loop_
_Sample_condition_variable.Type
_Sample_condition_variable.Val
_Sample_condition_variable.Val_err
_Sample_condition_variable.Val_units
_Sample_condition_variable.Entry_ID
_Sample_condition_variable.Sample_condition_list_ID
'ionic strength' 75 . mM 50671 1
pH 6.2 . pH 50671 1
pressure 1 . atm 50671 1
temperature 293 . K 50671 1
stop_
save_
############################
# Computer software used #
############################
save_software_1
_Software.Sf_category software
_Software.Sf_framecode software_1
_Software.Entry_ID 50671
_Software.ID 1
_Software.Type .
_Software.Name LOGS
_Software.Version 2.2
_Software.DOI .
_Software.Details .
loop_
_Task.Task
_Task.Software_module
_Task.Entry_ID
_Task.Software_ID
collection . 50671 1
stop_
save_
save_software_2
_Software.Sf_category software
_Software.Sf_framecode software_2
_Software.Entry_ID 50671
_Software.ID 2
_Software.Type .
_Software.Name TOPSPIN
_Software.Version 4.0.9
_Software.DOI .
_Software.Details .
loop_
_Task.Task
_Task.Software_module
_Task.Entry_ID
_Task.Software_ID
collection . 50671 2
'data analysis' . 50671 2
stop_
save_
#########################
# Experimental detail #
#########################
##################################
# NMR Spectrometer definitions #
##################################
save_NMR_spectrometer_1
_NMR_spectrometer.Sf_category NMR_spectrometer
_NMR_spectrometer.Sf_framecode NMR_spectrometer_1
_NMR_spectrometer.Entry_ID 50671
_NMR_spectrometer.ID 1
_NMR_spectrometer.Name 'Bruker Avance III HD 600 MHz'
_NMR_spectrometer.Details .
_NMR_spectrometer.Manufacturer Bruker
_NMR_spectrometer.Model 'Bruker Avance III'
_NMR_spectrometer.Serial_number .
_NMR_spectrometer.Field_strength 600
save_
#############################
# NMR applied experiments #
#############################
save_experiment_list_1
_Experiment_list.Sf_category experiment_list
_Experiment_list.Sf_framecode experiment_list_1
_Experiment_list.Entry_ID 50671
_Experiment_list.ID 1
_Experiment_list.Details .
loop_
_Experiment.ID
_Experiment.Name
_Experiment.Raw_data_flag
_Experiment.NUS_flag
_Experiment.Interleaved_flag
_Experiment.NMR_spec_expt_ID
_Experiment.NMR_spec_expt_label
_Experiment.MS_expt_ID
_Experiment.MS_expt_label
_Experiment.SAXS_expt_ID
_Experiment.SAXS_expt_label
_Experiment.FRET_expt_ID
_Experiment.FRET_expt_label
_Experiment.EMR_expt_ID
_Experiment.EMR_expt_label
_Experiment.Sample_ID
_Experiment.Sample_label
_Experiment.Sample_state
_Experiment.Sample_volume
_Experiment.Sample_volume_units
_Experiment.Sample_condition_list_ID
_Experiment.Sample_condition_list_label
_Experiment.Sample_spinning_rate
_Experiment.Sample_angle
_Experiment.NMR_tube_type
_Experiment.NMR_spectrometer_ID
_Experiment.NMR_spectrometer_label
_Experiment.NMR_spectrometer_probe_ID
_Experiment.NMR_spectrometer_probe_label
_Experiment.NMR_spectral_processing_ID
_Experiment.NMR_spectral_processing_label
_Experiment.Mass_spectrometer_ID
_Experiment.Mass_spectrometer_label
_Experiment.Xray_instrument_ID
_Experiment.Xray_instrument_label
_Experiment.Fluorescence_instrument_ID
_Experiment.Fluorescence_instrument_label
_Experiment.EMR_instrument_ID
_Experiment.EMR_instrument_label
_Experiment.Chromatographic_system_ID
_Experiment.Chromatographic_system_label
_Experiment.Chromatographic_column_ID
_Experiment.Chromatographic_column_label
_Experiment.Details
_Experiment.Entry_ID
_Experiment.Experiment_list_ID
1 '1D 1H' yes no no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 50671 1
2 '1D 1H waterLOGSY' yes no no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 50671 1
3 '1H R2 CPMG 5ms' yes no no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 50671 1
4 '1H R2 CPMG 100ms' yes no no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 50671 1
5 '1D 1H ref' yes no no . . . . . . . . . . 2 $sample_2 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 50671 1
6 '1D 1H waterLOGSY ref' yes no no . . . . . . . . . . 2 $sample_2 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 50671 1
7 '1H R2 CPMG 5ms ref' yes no no . . . . . . . . . . 2 $sample_2 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 50671 1
8 '1H R2 CPMG 100ms ref' yes no no . . . . . . . . . . 2 $sample_2 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 50671 1
stop_
loop_
_Experiment_file.Experiment_ID
_Experiment_file.Experiment_name
_Experiment_file.Name
_Experiment_file.Type
_Experiment_file.Content
_Experiment_file.Directory_path
_Experiment_file.Details
_Experiment_file.Entry_ID
_Experiment_file.Experiment_list_ID
1 '1D 1H' 17_Hits_5_SL5_DSI-PL_COVID19.xlsx . 'RNA fragment binding data' . . 50671 1
1 '1D 1H' Covid19-RNA_Screen_5_SL5.zip . 'Time-domain (raw spectral data)' . . 50671 1
2 '1D 1H waterLOGSY' 17_Hits_5_SL5_DSI-PL_COVID19.xlsx . 'RNA fragment binding data' . . 50671 1
2 '1D 1H waterLOGSY' Covid19-RNA_Screen_5_SL5.zip . 'Time-domain (raw spectral data)' . . 50671 1
3 '1H R2 CPMG 5ms' 17_Hits_5_SL5_DSI-PL_COVID19.xlsx . 'RNA fragment binding data' . . 50671 1
3 '1H R2 CPMG 5ms' Covid19-RNA_Screen_5_SL5.zip . 'Time-domain (raw spectral data)' . . 50671 1
4 '1H R2 CPMG 100ms' 17_Hits_5_SL5_DSI-PL_COVID19.xlsx . 'RNA fragment binding data' . . 50671 1
4 '1H R2 CPMG 100ms' Covid19-RNA_Screen_5_SL5.zip . 'Time-domain (raw spectral data)' . . 50671 1
5 '1D 1H ref' 17_Hits_5_SL5_DSI-PL_COVID19.xlsx . 'RNA fragment binding data' . . 50671 1
5 '1D 1H ref' Covid19-RNA_Screen_5_SL5.zip . 'Time-domain (raw spectral data)' . . 50671 1
6 '1D 1H waterLOGSY ref' 17_Hits_5_SL5_DSI-PL_COVID19.xlsx . 'RNA fragment binding data' . . 50671 1
6 '1D 1H waterLOGSY ref' Covid19-RNA_Screen_5_SL5.zip . 'Time-domain (raw spectral data)' . . 50671 1
7 '1H R2 CPMG 5ms ref' 17_Hits_5_SL5_DSI-PL_COVID19.xlsx . 'RNA fragment binding data' . . 50671 1
7 '1H R2 CPMG 5ms ref' Covid19-RNA_Screen_5_SL5.zip . 'Time-domain (raw spectral data)' . . 50671 1
8 '1H R2 CPMG 100ms ref' 17_Hits_5_SL5_DSI-PL_COVID19.xlsx . 'RNA fragment binding data' . . 50671 1
8 '1H R2 CPMG 100ms ref' Covid19-RNA_Screen_5_SL5.zip . 'Time-domain (raw spectral data)' . . 50671 1
stop_
save_
#########################
# Other kinds of data #
#########################
save_other_data_types_1
_Other_data_type_list.Sf_category other_data_types
_Other_data_type_list.Sf_framecode other_data_types_1
_Other_data_type_list.Entry_ID 50671
_Other_data_type_list.ID 1
_Other_data_type_list.Name 'RNA fragment binding data'
_Other_data_type_list.Definition 'RNA fragment binding data'
_Other_data_type_list.Sample_condition_list_ID 1
_Other_data_type_list.Sample_condition_list_label $sample_conditions_1
_Other_data_type_list.Chem_shift_reference_ID .
_Other_data_type_list.Chem_shift_reference_label .
_Other_data_type_list.Details
;
Fragment Based Screening;
The dataset is linked through "_Experiment_file.#" loop.
;
_Other_data_type_list.Text_data_format .
_Other_data_type_list.Text_data .
loop_
_Other_data_experiment.Experiment_ID
_Other_data_experiment.Experiment_name
_Other_data_experiment.Sample_ID
_Other_data_experiment.Sample_label
_Other_data_experiment.Sample_state
_Other_data_experiment.Entry_ID
_Other_data_experiment.Other_data_type_list_ID
1 '1D 1H' . . . 50671 1
2 '1D 1H waterLOGSY' . . . 50671 1
3 '1H R2 CPMG 5ms' . . . 50671 1
4 '1H R2 CPMG 100ms' . . . 50671 1
5 '1D 1H ref' . . . 50671 1
6 '1D 1H waterLOGSY ref' . . . 50671 1
7 '1H R2 CPMG 5ms ref' . . . 50671 1
8 '1H R2 CPMG 100ms ref' . . . 50671 1
stop_
loop_
_Other_data_software.Software_ID
_Other_data_software.Software_label
_Other_data_software.Method_ID
_Other_data_software.Method_label
_Other_data_software.Entry_ID
_Other_data_software.Other_data_type_list_ID
1 $software_1 . . 50671 1
2 $software_2 . . 50671 1
stop_
save_